ID: 1052524071

View in Genome Browser
Species Human (GRCh38)
Location 9:29590228-29590250
Sequence AAGTACAGGATTGCAACTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052524068_1052524071 -8 Left 1052524068 9:29590213-29590235 CCTGGAAACAAAGGTAAGTACAG No data
Right 1052524071 9:29590228-29590250 AAGTACAGGATTGCAACTTAGGG No data
1052524067_1052524071 -5 Left 1052524067 9:29590210-29590232 CCTCCTGGAAACAAAGGTAAGTA No data
Right 1052524071 9:29590228-29590250 AAGTACAGGATTGCAACTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052524071 Original CRISPR AAGTACAGGATTGCAACTTA GGG Intergenic
No off target data available for this crispr