ID: 1052528715

View in Genome Browser
Species Human (GRCh38)
Location 9:29655210-29655232
Sequence ACACCAGGGGGTTATCGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052528707_1052528715 24 Left 1052528707 9:29655163-29655185 CCAGCGGAGTCAAAGGATTGAGA 0: 21
1: 64
2: 123
3: 77
4: 141
Right 1052528715 9:29655210-29655232 ACACCAGGGGGTTATCGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052528715 Original CRISPR ACACCAGGGGGTTATCGTGG AGG Intergenic
No off target data available for this crispr