ID: 1052528803

View in Genome Browser
Species Human (GRCh38)
Location 9:29655897-29655919
Sequence CTGAATGCAAAGATGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052528803_1052528813 26 Left 1052528803 9:29655897-29655919 CCTTGTTCCATCTTTGCATTCAG No data
Right 1052528813 9:29655946-29655968 GGGGAACCTGGTCCATGGTTGGG No data
1052528803_1052528812 25 Left 1052528803 9:29655897-29655919 CCTTGTTCCATCTTTGCATTCAG No data
Right 1052528812 9:29655945-29655967 GGGGGAACCTGGTCCATGGTTGG No data
1052528803_1052528809 7 Left 1052528803 9:29655897-29655919 CCTTGTTCCATCTTTGCATTCAG No data
Right 1052528809 9:29655927-29655949 TGACTCATGGCTCTTACTGGGGG No data
1052528803_1052528811 21 Left 1052528803 9:29655897-29655919 CCTTGTTCCATCTTTGCATTCAG No data
Right 1052528811 9:29655941-29655963 TACTGGGGGAACCTGGTCCATGG No data
1052528803_1052528806 4 Left 1052528803 9:29655897-29655919 CCTTGTTCCATCTTTGCATTCAG No data
Right 1052528806 9:29655924-29655946 AACTGACTCATGGCTCTTACTGG No data
1052528803_1052528807 5 Left 1052528803 9:29655897-29655919 CCTTGTTCCATCTTTGCATTCAG No data
Right 1052528807 9:29655925-29655947 ACTGACTCATGGCTCTTACTGGG No data
1052528803_1052528805 -6 Left 1052528803 9:29655897-29655919 CCTTGTTCCATCTTTGCATTCAG No data
Right 1052528805 9:29655914-29655936 ATTCAGATTCAACTGACTCATGG No data
1052528803_1052528810 14 Left 1052528803 9:29655897-29655919 CCTTGTTCCATCTTTGCATTCAG No data
Right 1052528810 9:29655934-29655956 TGGCTCTTACTGGGGGAACCTGG No data
1052528803_1052528808 6 Left 1052528803 9:29655897-29655919 CCTTGTTCCATCTTTGCATTCAG No data
Right 1052528808 9:29655926-29655948 CTGACTCATGGCTCTTACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052528803 Original CRISPR CTGAATGCAAAGATGGAACA AGG (reversed) Intergenic
No off target data available for this crispr