ID: 1052528806

View in Genome Browser
Species Human (GRCh38)
Location 9:29655924-29655946
Sequence AACTGACTCATGGCTCTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052528803_1052528806 4 Left 1052528803 9:29655897-29655919 CCTTGTTCCATCTTTGCATTCAG No data
Right 1052528806 9:29655924-29655946 AACTGACTCATGGCTCTTACTGG No data
1052528804_1052528806 -3 Left 1052528804 9:29655904-29655926 CCATCTTTGCATTCAGATTCAAC No data
Right 1052528806 9:29655924-29655946 AACTGACTCATGGCTCTTACTGG No data
1052528802_1052528806 13 Left 1052528802 9:29655888-29655910 CCGGTTGGTCCTTGTTCCATCTT No data
Right 1052528806 9:29655924-29655946 AACTGACTCATGGCTCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052528806 Original CRISPR AACTGACTCATGGCTCTTAC TGG Intergenic
No off target data available for this crispr