ID: 1052528813

View in Genome Browser
Species Human (GRCh38)
Location 9:29655946-29655968
Sequence GGGGAACCTGGTCCATGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052528804_1052528813 19 Left 1052528804 9:29655904-29655926 CCATCTTTGCATTCAGATTCAAC No data
Right 1052528813 9:29655946-29655968 GGGGAACCTGGTCCATGGTTGGG No data
1052528803_1052528813 26 Left 1052528803 9:29655897-29655919 CCTTGTTCCATCTTTGCATTCAG No data
Right 1052528813 9:29655946-29655968 GGGGAACCTGGTCCATGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052528813 Original CRISPR GGGGAACCTGGTCCATGGTT GGG Intergenic
No off target data available for this crispr