ID: 1052529116

View in Genome Browser
Species Human (GRCh38)
Location 9:29658168-29658190
Sequence TGATGGGAATACATCTTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052529116_1052529122 26 Left 1052529116 9:29658168-29658190 CCCATCAAGATGTATTCCCATCA No data
Right 1052529122 9:29658217-29658239 AGATGATGTAGGTAACCTTTTGG No data
1052529116_1052529121 15 Left 1052529116 9:29658168-29658190 CCCATCAAGATGTATTCCCATCA No data
Right 1052529121 9:29658206-29658228 ATTCATTTCAGAGATGATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052529116 Original CRISPR TGATGGGAATACATCTTGAT GGG (reversed) Intergenic
No off target data available for this crispr