ID: 1052532174

View in Genome Browser
Species Human (GRCh38)
Location 9:29700309-29700331
Sequence GATTGTGGATCTACATCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052532169_1052532174 20 Left 1052532169 9:29700266-29700288 CCCAGTCACAGTTATATTGAGGA No data
Right 1052532174 9:29700309-29700331 GATTGTGGATCTACATCTTAAGG No data
1052532167_1052532174 21 Left 1052532167 9:29700265-29700287 CCCCAGTCACAGTTATATTGAGG No data
Right 1052532174 9:29700309-29700331 GATTGTGGATCTACATCTTAAGG No data
1052532170_1052532174 19 Left 1052532170 9:29700267-29700289 CCAGTCACAGTTATATTGAGGAT No data
Right 1052532174 9:29700309-29700331 GATTGTGGATCTACATCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052532174 Original CRISPR GATTGTGGATCTACATCTTA AGG Intergenic
No off target data available for this crispr