ID: 1052533063

View in Genome Browser
Species Human (GRCh38)
Location 9:29712734-29712756
Sequence TCAGTGCTGATTAAAGCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052533059_1052533063 19 Left 1052533059 9:29712692-29712714 CCTTCATGAAATTAGAAGGGACA No data
Right 1052533063 9:29712734-29712756 TCAGTGCTGATTAAAGCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052533063 Original CRISPR TCAGTGCTGATTAAAGCCGG AGG Intergenic
No off target data available for this crispr