ID: 1052538669

View in Genome Browser
Species Human (GRCh38)
Location 9:29778869-29778891
Sequence ACCTAGGAGAAACTCCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052538669_1052538672 -3 Left 1052538669 9:29778869-29778891 CCTGAAGGGAGTTTCTCCTAGGT No data
Right 1052538672 9:29778889-29778911 GGTCTGGTCAGACCTTTGTATGG 0: 40
1: 82
2: 96
3: 77
4: 128
1052538669_1052538674 24 Left 1052538669 9:29778869-29778891 CCTGAAGGGAGTTTCTCCTAGGT No data
Right 1052538674 9:29778916-29778938 TAAGATTTAAATCCCTCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052538669 Original CRISPR ACCTAGGAGAAACTCCCTTC AGG (reversed) Intergenic
No off target data available for this crispr