ID: 1052546655

View in Genome Browser
Species Human (GRCh38)
Location 9:29889009-29889031
Sequence CCAGTGAAGAAGGATGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052546655_1052546668 26 Left 1052546655 9:29889009-29889031 CCTGACCCATCCTTCTTCACTGG No data
Right 1052546668 9:29889058-29889080 TAACTCCATTTAGAGGCTCAGGG No data
1052546655_1052546667 25 Left 1052546655 9:29889009-29889031 CCTGACCCATCCTTCTTCACTGG No data
Right 1052546667 9:29889057-29889079 ATAACTCCATTTAGAGGCTCAGG No data
1052546655_1052546664 -5 Left 1052546655 9:29889009-29889031 CCTGACCCATCCTTCTTCACTGG No data
Right 1052546664 9:29889027-29889049 ACTGGGTGGGGCTTTTCTGCAGG No data
1052546655_1052546665 19 Left 1052546655 9:29889009-29889031 CCTGACCCATCCTTCTTCACTGG No data
Right 1052546665 9:29889051-29889073 AGTCCAATAACTCCATTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052546655 Original CRISPR CCAGTGAAGAAGGATGGGTC AGG (reversed) Intergenic
No off target data available for this crispr