ID: 1052549717

View in Genome Browser
Species Human (GRCh38)
Location 9:29932288-29932310
Sequence AGCTAGAAGCTATAGACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052549717_1052549721 8 Left 1052549717 9:29932288-29932310 CCTCCAGTCTATAGCTTCTAGCT No data
Right 1052549721 9:29932319-29932341 TATTGCTCCACTCTCTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052549717 Original CRISPR AGCTAGAAGCTATAGACTGG AGG (reversed) Intergenic
No off target data available for this crispr