ID: 1052551895

View in Genome Browser
Species Human (GRCh38)
Location 9:29962503-29962525
Sequence CTCTGCTGATTGAAGTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052551892_1052551895 10 Left 1052551892 9:29962470-29962492 CCGCTGTTGATTTTTACCTGAAT No data
Right 1052551895 9:29962503-29962525 CTCTGCTGATTGAAGTGTCCAGG No data
1052551893_1052551895 -6 Left 1052551893 9:29962486-29962508 CCTGAATGATTCTTAGCCTCTGC No data
Right 1052551895 9:29962503-29962525 CTCTGCTGATTGAAGTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052551895 Original CRISPR CTCTGCTGATTGAAGTGTCC AGG Intergenic
No off target data available for this crispr