ID: 1052556089

View in Genome Browser
Species Human (GRCh38)
Location 9:30019874-30019896
Sequence GCCTCAGGTTAGTTTAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052556089_1052556094 1 Left 1052556089 9:30019874-30019896 CCTGGCTTAAACTAACCTGAGGC No data
Right 1052556094 9:30019898-30019920 CAGAGGAATTAACAGAAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052556089 Original CRISPR GCCTCAGGTTAGTTTAAGCC AGG (reversed) Intergenic