ID: 1052559912

View in Genome Browser
Species Human (GRCh38)
Location 9:30071768-30071790
Sequence GGTATCACCTAAAACCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052559909_1052559912 14 Left 1052559909 9:30071731-30071753 CCAGTCATCAGGGAAATACAAAT No data
Right 1052559912 9:30071768-30071790 GGTATCACCTAAAACCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052559912 Original CRISPR GGTATCACCTAAAACCTGCT AGG Intergenic
No off target data available for this crispr