ID: 1052561525

View in Genome Browser
Species Human (GRCh38)
Location 9:30089748-30089770
Sequence GACGGCTCTTGCCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052561525_1052561529 22 Left 1052561525 9:30089748-30089770 CCAGTAACAGGGCAAGAGCCGTC No data
Right 1052561529 9:30089793-30089815 CTGCAGAAGATGGCAGACGATGG No data
1052561525_1052561528 12 Left 1052561525 9:30089748-30089770 CCAGTAACAGGGCAAGAGCCGTC No data
Right 1052561528 9:30089783-30089805 GAATAGTTATCTGCAGAAGATGG 0: 14
1: 194
2: 203
3: 139
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052561525 Original CRISPR GACGGCTCTTGCCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr