ID: 1052569594

View in Genome Browser
Species Human (GRCh38)
Location 9:30202247-30202269
Sequence AAGTGCTATCTCATTTAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052569594_1052569596 -4 Left 1052569594 9:30202247-30202269 CCGCCTTAAATGAGATAGCACTT No data
Right 1052569596 9:30202266-30202288 ACTTCTAGCTGACATCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052569594 Original CRISPR AAGTGCTATCTCATTTAAGG CGG (reversed) Intergenic
No off target data available for this crispr