ID: 1052577119

View in Genome Browser
Species Human (GRCh38)
Location 9:30304713-30304735
Sequence GTCTAACTGGACCACAGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052577119_1052577121 -10 Left 1052577119 9:30304713-30304735 CCAAAACTGTGGTCCAGTTAGAC No data
Right 1052577121 9:30304726-30304748 CCAGTTAGACTAACGACTTATGG No data
1052577119_1052577123 -2 Left 1052577119 9:30304713-30304735 CCAAAACTGTGGTCCAGTTAGAC No data
Right 1052577123 9:30304734-30304756 ACTAACGACTTATGGAGGTCAGG No data
1052577119_1052577122 -7 Left 1052577119 9:30304713-30304735 CCAAAACTGTGGTCCAGTTAGAC No data
Right 1052577122 9:30304729-30304751 GTTAGACTAACGACTTATGGAGG No data
1052577119_1052577124 8 Left 1052577119 9:30304713-30304735 CCAAAACTGTGGTCCAGTTAGAC No data
Right 1052577124 9:30304744-30304766 TATGGAGGTCAGGTAATCAATGG 0: 5
1: 137
2: 174
3: 157
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052577119 Original CRISPR GTCTAACTGGACCACAGTTT TGG (reversed) Intergenic
No off target data available for this crispr