ID: 1052581829

View in Genome Browser
Species Human (GRCh38)
Location 9:30366747-30366769
Sequence CTCCATTAAAAGATGGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052581829_1052581832 20 Left 1052581829 9:30366747-30366769 CCTTTGCCCATCTTTTAATGGAG No data
Right 1052581832 9:30366790-30366812 AAATTGTTTCTTATAGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052581829 Original CRISPR CTCCATTAAAAGATGGGCAA AGG (reversed) Intergenic
No off target data available for this crispr