ID: 1052586227

View in Genome Browser
Species Human (GRCh38)
Location 9:30431359-30431381
Sequence CTCAAACTATTCCAAAATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052586224_1052586227 2 Left 1052586224 9:30431334-30431356 CCTTTAAAGAAGAATACCAATCC No data
Right 1052586227 9:30431359-30431381 CTCAAACTATTCCAAAATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052586227 Original CRISPR CTCAAACTATTCCAAAATAG AGG Intergenic
No off target data available for this crispr