ID: 1052586444

View in Genome Browser
Species Human (GRCh38)
Location 9:30435158-30435180
Sequence GGGGTGGAATGTGTTGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052586444_1052586458 17 Left 1052586444 9:30435158-30435180 CCCATCCCAACACATTCCACCCC No data
Right 1052586458 9:30435198-30435220 CTAAAGAAATTGACATTATTTGG No data
1052586444_1052586459 29 Left 1052586444 9:30435158-30435180 CCCATCCCAACACATTCCACCCC No data
Right 1052586459 9:30435210-30435232 ACATTATTTGGAGCAGACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052586444 Original CRISPR GGGGTGGAATGTGTTGGGAT GGG (reversed) Intergenic