ID: 1052586447 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:30435163-30435185 |
Sequence | ACCTGGGGGTGGAATGTGTT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1052586447_1052586459 | 24 | Left | 1052586447 | 9:30435163-30435185 | CCCAACACATTCCACCCCCAGGT | No data | ||
Right | 1052586459 | 9:30435210-30435232 | ACATTATTTGGAGCAGACTATGG | No data | ||||
1052586447_1052586458 | 12 | Left | 1052586447 | 9:30435163-30435185 | CCCAACACATTCCACCCCCAGGT | No data | ||
Right | 1052586458 | 9:30435198-30435220 | CTAAAGAAATTGACATTATTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1052586447 | Original CRISPR | ACCTGGGGGTGGAATGTGTT GGG (reversed) | Intergenic | ||