ID: 1052586448

View in Genome Browser
Species Human (GRCh38)
Location 9:30435164-30435186
Sequence GACCTGGGGGTGGAATGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052586448_1052586459 23 Left 1052586448 9:30435164-30435186 CCAACACATTCCACCCCCAGGTC No data
Right 1052586459 9:30435210-30435232 ACATTATTTGGAGCAGACTATGG No data
1052586448_1052586458 11 Left 1052586448 9:30435164-30435186 CCAACACATTCCACCCCCAGGTC No data
Right 1052586458 9:30435198-30435220 CTAAAGAAATTGACATTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052586448 Original CRISPR GACCTGGGGGTGGAATGTGT TGG (reversed) Intergenic