ID: 1052586454

View in Genome Browser
Species Human (GRCh38)
Location 9:30435180-30435202
Sequence TTTAGGTGGGACCACAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052586454_1052586458 -5 Left 1052586454 9:30435180-30435202 CCAGGTCTGTGGTCCCACCTAAA No data
Right 1052586458 9:30435198-30435220 CTAAAGAAATTGACATTATTTGG No data
1052586454_1052586459 7 Left 1052586454 9:30435180-30435202 CCAGGTCTGTGGTCCCACCTAAA No data
Right 1052586459 9:30435210-30435232 ACATTATTTGGAGCAGACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052586454 Original CRISPR TTTAGGTGGGACCACAGACC TGG (reversed) Intergenic