ID: 1052586455

View in Genome Browser
Species Human (GRCh38)
Location 9:30435193-30435215
Sequence TAATGTCAATTTCTTTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052586455_1052586459 -6 Left 1052586455 9:30435193-30435215 CCCACCTAAAGAAATTGACATTA No data
Right 1052586459 9:30435210-30435232 ACATTATTTGGAGCAGACTATGG No data
1052586455_1052586460 21 Left 1052586455 9:30435193-30435215 CCCACCTAAAGAAATTGACATTA No data
Right 1052586460 9:30435237-30435259 ATTCATGCCCAAGAATGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052586455 Original CRISPR TAATGTCAATTTCTTTAGGT GGG (reversed) Intergenic