ID: 1052586457 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:30435197-30435219 |
Sequence | CAAATAATGTCAATTTCTTT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1052586457_1052586460 | 17 | Left | 1052586457 | 9:30435197-30435219 | CCTAAAGAAATTGACATTATTTG | No data | ||
Right | 1052586460 | 9:30435237-30435259 | ATTCATGCCCAAGAATGTTGTGG | No data | ||||
1052586457_1052586459 | -10 | Left | 1052586457 | 9:30435197-30435219 | CCTAAAGAAATTGACATTATTTG | No data | ||
Right | 1052586459 | 9:30435210-30435232 | ACATTATTTGGAGCAGACTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1052586457 | Original CRISPR | CAAATAATGTCAATTTCTTT AGG (reversed) | Intergenic | ||