ID: 1052586459

View in Genome Browser
Species Human (GRCh38)
Location 9:30435210-30435232
Sequence ACATTATTTGGAGCAGACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052586445_1052586459 28 Left 1052586445 9:30435159-30435181 CCATCCCAACACATTCCACCCCC No data
Right 1052586459 9:30435210-30435232 ACATTATTTGGAGCAGACTATGG No data
1052586456_1052586459 -7 Left 1052586456 9:30435194-30435216 CCACCTAAAGAAATTGACATTAT No data
Right 1052586459 9:30435210-30435232 ACATTATTTGGAGCAGACTATGG No data
1052586453_1052586459 8 Left 1052586453 9:30435179-30435201 CCCAGGTCTGTGGTCCCACCTAA No data
Right 1052586459 9:30435210-30435232 ACATTATTTGGAGCAGACTATGG No data
1052586451_1052586459 10 Left 1052586451 9:30435177-30435199 CCCCCAGGTCTGTGGTCCCACCT No data
Right 1052586459 9:30435210-30435232 ACATTATTTGGAGCAGACTATGG No data
1052586454_1052586459 7 Left 1052586454 9:30435180-30435202 CCAGGTCTGTGGTCCCACCTAAA No data
Right 1052586459 9:30435210-30435232 ACATTATTTGGAGCAGACTATGG No data
1052586455_1052586459 -6 Left 1052586455 9:30435193-30435215 CCCACCTAAAGAAATTGACATTA No data
Right 1052586459 9:30435210-30435232 ACATTATTTGGAGCAGACTATGG No data
1052586452_1052586459 9 Left 1052586452 9:30435178-30435200 CCCCAGGTCTGTGGTCCCACCTA No data
Right 1052586459 9:30435210-30435232 ACATTATTTGGAGCAGACTATGG No data
1052586447_1052586459 24 Left 1052586447 9:30435163-30435185 CCCAACACATTCCACCCCCAGGT No data
Right 1052586459 9:30435210-30435232 ACATTATTTGGAGCAGACTATGG No data
1052586450_1052586459 13 Left 1052586450 9:30435174-30435196 CCACCCCCAGGTCTGTGGTCCCA No data
Right 1052586459 9:30435210-30435232 ACATTATTTGGAGCAGACTATGG No data
1052586444_1052586459 29 Left 1052586444 9:30435158-30435180 CCCATCCCAACACATTCCACCCC No data
Right 1052586459 9:30435210-30435232 ACATTATTTGGAGCAGACTATGG No data
1052586457_1052586459 -10 Left 1052586457 9:30435197-30435219 CCTAAAGAAATTGACATTATTTG No data
Right 1052586459 9:30435210-30435232 ACATTATTTGGAGCAGACTATGG No data
1052586448_1052586459 23 Left 1052586448 9:30435164-30435186 CCAACACATTCCACCCCCAGGTC No data
Right 1052586459 9:30435210-30435232 ACATTATTTGGAGCAGACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052586459 Original CRISPR ACATTATTTGGAGCAGACTA TGG Intergenic