ID: 1052586460

View in Genome Browser
Species Human (GRCh38)
Location 9:30435237-30435259
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052586455_1052586460 21 Left 1052586455 9:30435193-30435215 CCCACCTAAAGAAATTGACATTA No data
Right 1052586460 9:30435237-30435259 ATTCATGCCCAAGAATGTTGTGG No data
1052586457_1052586460 17 Left 1052586457 9:30435197-30435219 CCTAAAGAAATTGACATTATTTG No data
Right 1052586460 9:30435237-30435259 ATTCATGCCCAAGAATGTTGTGG No data
1052586456_1052586460 20 Left 1052586456 9:30435194-30435216 CCACCTAAAGAAATTGACATTAT No data
Right 1052586460 9:30435237-30435259 ATTCATGCCCAAGAATGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052586460 Original CRISPR ATTCATGCCCAAGAATGTTG TGG Intergenic
No off target data available for this crispr