ID: 1052600948

View in Genome Browser
Species Human (GRCh38)
Location 9:30629852-30629874
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052600948_1052600951 2 Left 1052600948 9:30629852-30629874 CCTGTTGGTCCTAAAATAGAACC No data
Right 1052600951 9:30629877-30629899 TTAAAATTTTTAATTAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052600948 Original CRISPR GGTTCTATTTTAGGACCAAC AGG (reversed) Intergenic
No off target data available for this crispr