ID: 1052604825

View in Genome Browser
Species Human (GRCh38)
Location 9:30686407-30686429
Sequence CTATAAAGACACATGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052604819_1052604825 27 Left 1052604819 9:30686357-30686379 CCCACAATCTCATTACTGGGTGT 0: 3
1: 63
2: 1225
3: 8859
4: 25083
Right 1052604825 9:30686407-30686429 CTATAAAGACACATGCAGCTGGG No data
1052604818_1052604825 28 Left 1052604818 9:30686356-30686378 CCCCACAATCTCATTACTGGGTG No data
Right 1052604825 9:30686407-30686429 CTATAAAGACACATGCAGCTGGG No data
1052604822_1052604825 1 Left 1052604822 9:30686383-30686405 CCCAAAGGATTATAAATCATTCT 0: 3373
1: 12867
2: 14730
3: 6935
4: 3607
Right 1052604825 9:30686407-30686429 CTATAAAGACACATGCAGCTGGG No data
1052604823_1052604825 0 Left 1052604823 9:30686384-30686406 CCAAAGGATTATAAATCATTCTA 0: 3240
1: 6144
2: 12287
3: 14089
4: 6978
Right 1052604825 9:30686407-30686429 CTATAAAGACACATGCAGCTGGG No data
1052604820_1052604825 26 Left 1052604820 9:30686358-30686380 CCACAATCTCATTACTGGGTGTA No data
Right 1052604825 9:30686407-30686429 CTATAAAGACACATGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052604825 Original CRISPR CTATAAAGACACATGCAGCT GGG Intergenic
No off target data available for this crispr