ID: 1052606200

View in Genome Browser
Species Human (GRCh38)
Location 9:30705250-30705272
Sequence CCTCAGGATCAAAAGATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052606200_1052606206 15 Left 1052606200 9:30705250-30705272 CCTTTAATCTTTTGATCCTGAGG No data
Right 1052606206 9:30705288-30705310 AGTACCTATAAAGACTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052606200 Original CRISPR CCTCAGGATCAAAAGATTAA AGG (reversed) Intergenic
No off target data available for this crispr