ID: 1052609894

View in Genome Browser
Species Human (GRCh38)
Location 9:30758859-30758881
Sequence GTAAATAAATGGACGGTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052609894_1052609904 29 Left 1052609894 9:30758859-30758881 CCATGGACCGTCCATTTATTTAC No data
Right 1052609904 9:30758911-30758933 ACATGTCCTCCACGGAGCCCAGG No data
1052609894_1052609902 21 Left 1052609894 9:30758859-30758881 CCATGGACCGTCCATTTATTTAC No data
Right 1052609902 9:30758903-30758925 CGCCATAAACATGTCCTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052609894 Original CRISPR GTAAATAAATGGACGGTCCA TGG (reversed) Intergenic
No off target data available for this crispr