ID: 1052609902

View in Genome Browser
Species Human (GRCh38)
Location 9:30758903-30758925
Sequence CGCCATAAACATGTCCTCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052609898_1052609902 10 Left 1052609898 9:30758870-30758892 CCATTTATTTACAGGAGGCTGTC No data
Right 1052609902 9:30758903-30758925 CGCCATAAACATGTCCTCCACGG No data
1052609897_1052609902 14 Left 1052609897 9:30758866-30758888 CCGTCCATTTATTTACAGGAGGC No data
Right 1052609902 9:30758903-30758925 CGCCATAAACATGTCCTCCACGG No data
1052609894_1052609902 21 Left 1052609894 9:30758859-30758881 CCATGGACCGTCCATTTATTTAC No data
Right 1052609902 9:30758903-30758925 CGCCATAAACATGTCCTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052609902 Original CRISPR CGCCATAAACATGTCCTCCA CGG Intergenic
No off target data available for this crispr