ID: 1052611063

View in Genome Browser
Species Human (GRCh38)
Location 9:30774198-30774220
Sequence CTGAGCCAGCTCTTCGTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 77}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052611063_1052611067 23 Left 1052611063 9:30774198-30774220 CCAATAACGAAGAGCTGGCTCAG 0: 1
1: 0
2: 2
3: 6
4: 77
Right 1052611067 9:30774244-30774266 GTACTGGTCTCAGCAGATTGAGG 0: 19
1: 14
2: 21
3: 13
4: 103
1052611063_1052611066 7 Left 1052611063 9:30774198-30774220 CCAATAACGAAGAGCTGGCTCAG 0: 1
1: 0
2: 2
3: 6
4: 77
Right 1052611066 9:30774228-30774250 GAGAGGATCTAGAAAAGTACTGG 0: 1
1: 0
2: 5
3: 40
4: 173
1052611063_1052611064 -10 Left 1052611063 9:30774198-30774220 CCAATAACGAAGAGCTGGCTCAG 0: 1
1: 0
2: 2
3: 6
4: 77
Right 1052611064 9:30774211-30774233 GCTGGCTCAGAAGAACCGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052611063 Original CRISPR CTGAGCCAGCTCTTCGTTAT TGG (reversed) Intergenic
904479533 1:30785325-30785347 CTGAGCCCGCACTTCGTTAAAGG - Intergenic
910393843 1:86771965-86771987 CTGACCCACCTCTTAGTTTTAGG + Intergenic
913252440 1:116923014-116923036 CTGCGTCAGCTCTTGGTGATGGG + Intronic
915535652 1:156533910-156533932 CTGAGCCAGGTCTTCCCTCTGGG + Intronic
920203631 1:204275940-204275962 CAGAGCCAGCTCTTTGCTGTGGG - Intronic
922426956 1:225506481-225506503 CCTAGCCAGCTCCTTGTTATGGG + Intronic
1072717286 10:97760390-97760412 CTGAGCCAGCTCATGGCTAAGGG - Exonic
1078675928 11:13414351-13414373 CTGAGCCAGGTCTTAATTTTGGG - Intronic
1080638717 11:34145850-34145872 CTGAGCCAGCTCTTAGTCTGTGG - Intronic
1081076023 11:38674978-38675000 CTGAGGTAGCTCTTAGCTATAGG - Intergenic
1085216654 11:74838753-74838775 CAGAGCCAGCTCTTCTGTTTTGG - Exonic
1089625537 11:119748612-119748634 CTGAGCCACCTCTTCCCTAGGGG - Intergenic
1090088183 11:123669871-123669893 CTCAGCCAGCTCTTCTTTTGTGG - Intergenic
1090532111 11:127601364-127601386 CTGTGCCATCTGTTCTTTATGGG + Intergenic
1093851992 12:24051518-24051540 TTGAACTAGCTCTTCGTTCTTGG - Intergenic
1098334385 12:69387608-69387630 ATGAGACAGCTCTGTGTTATAGG + Intronic
1102360005 12:112277450-112277472 CAGACCCAGCTCTTTTTTATTGG - Intronic
1113553163 13:111208904-111208926 CTGAGCCAGCTTTACCTGATGGG + Intronic
1114255392 14:20997270-20997292 CTGAGGAAGCTCTTCATTACAGG - Intergenic
1118966876 14:70595297-70595319 CTGAGCCAGCTCTTCGTATTAGG - Intronic
1121605904 14:95239628-95239650 CTTAGCAAGCTCTTCCTTTTTGG - Intronic
1123449578 15:20351465-20351487 CTGAGCCAGCTCTTAGTCCATGG - Intergenic
1130771696 15:86930633-86930655 ATGTGCTAGCTGTTCGTTATAGG + Intronic
1131003935 15:88960503-88960525 CTGAGCCAGCTCGTCATACTGGG - Intergenic
1132565805 16:622265-622287 CTGCGCCAGCTCTTGGGTAACGG - Intronic
1135891674 16:26363107-26363129 CTGTGGCAGCTCTTGGTTAATGG + Intergenic
1143922935 17:10345161-10345183 CTGGGACAGCTCCTCCTTATTGG - Intronic
1145917654 17:28585376-28585398 CTGAACCAGCTCTTCTTGCTTGG + Exonic
1146394809 17:32456336-32456358 CTGAGTGAGCTCTAGGTTATGGG - Intronic
1149602548 17:57902784-57902806 CTGGGCCAGCTCTCTGCTATAGG - Intronic
1150494158 17:65594409-65594431 CTGGGGCAGCTCCTCGTTACTGG - Intronic
1151791176 17:76307087-76307109 CTGAGCCAGCTCTGGGTCCTTGG + Intronic
1152339054 17:79714425-79714447 CTGAGCCAGCTCTTAGTCCACGG + Intergenic
1153062324 18:1006943-1006965 CTGAGGCACTTCTTCTTTATGGG + Intergenic
1153376502 18:4386582-4386604 CTGAGCCAGCTCTTTGACCTTGG - Intronic
1154315072 18:13297944-13297966 CTGGGCCCTCTCTTAGTTATAGG + Intronic
1161439947 19:4285287-4285309 CTCAGCCAGTTCTTGGTTCTTGG + Intronic
1162792735 19:13071450-13071472 CTGAGCCATCTCTTTGTTAGTGG - Intronic
1163696699 19:18767992-18768014 CTGAGCCAGCCCTTGGTGAGGGG + Intronic
925750157 2:7082361-7082383 CTGAGACAGCTCTTGGCTGTTGG - Intergenic
930234788 2:48878209-48878231 ATGAGCCAGAACTTCGTTACAGG - Intergenic
1171140057 20:22733309-22733331 CTGAGCCAGCTCGTCATATTGGG + Intergenic
1171442403 20:25175965-25175987 CTGAGCCTCCTCTTCATGATGGG + Intergenic
1173105593 20:40130515-40130537 ATGAGGCAGCTCTTGCTTATGGG + Intergenic
1173252180 20:41369904-41369926 CTGAGCCAGCTCCTCATCCTAGG + Intergenic
1174693800 20:52536986-52537008 CTGTGCTAGCTGTTTGTTATTGG + Intergenic
1177387357 21:20425458-20425480 CCGAGCCAGCTCATCGTATTGGG + Intergenic
1179769524 21:43603994-43604016 ATGAGCCAGCTCTGCATTCTGGG + Intronic
1184100310 22:42338490-42338512 CTGAGCGAGCTCTTCGGGATTGG - Intronic
1184320500 22:43739016-43739038 CTGAGACAGCTCATCTTCATGGG - Intronic
1184776876 22:46627691-46627713 CTGAGCCAGGTCTTCTTTCCAGG + Intronic
952697668 3:36288626-36288648 TTTAGCCAGCTTTTCATTATAGG - Intergenic
963089627 3:141471135-141471157 CTGAGCCAGCTCGTCATATTGGG + Intergenic
967833069 3:193938742-193938764 CTGCTCCAGCTCTTCCTTGTTGG + Intergenic
968601956 4:1513659-1513681 CTGAGCCCGGCCTTCTTTATAGG + Intergenic
970628134 4:17912455-17912477 CTGAGCCAGCTCATCGTATTGGG - Intronic
970887093 4:20998946-20998968 ATGAGCCAGCTCTTCTTTCTTGG + Intronic
970948334 4:21722214-21722236 CTAAGCCAGCTCTGCATTTTGGG + Intronic
980618516 4:135266585-135266607 CTGTCCCAGCTCTTGGTTAATGG - Intergenic
981422993 4:144572456-144572478 CTGAGCCATCTCTTTGTATTGGG - Intergenic
985017710 4:185654134-185654156 ATGAGTCAGCTCTTCATTCTCGG + Intronic
989012240 5:36885963-36885985 CTGAGCTAGCTCGTCGTATTGGG - Intronic
996452084 5:123636867-123636889 CTGAGCCAGCTCGTCATATTGGG - Intergenic
997631200 5:135370036-135370058 CTGATTCAGCTCTTCATCATTGG + Exonic
1000382719 5:160643664-160643686 CTGAGCCCTCTCTTTGCTATAGG + Intronic
1005748327 6:28860970-28860992 ATGAGCCAGTTTATCGTTATGGG - Intergenic
1007233873 6:40376633-40376655 CTGTGCCAGTTCTTCATTATTGG - Intergenic
1014984979 6:127994580-127994602 ATGAACCAGGTCTTCCTTATAGG + Intronic
1018103715 6:160464058-160464080 CAGAGCCTGCCCTTCGTCATGGG - Intergenic
1019304393 7:326012-326034 CAAAGCCAGCTCTTCCTCATGGG - Intergenic
1022051240 7:26675355-26675377 CTGAGTCAGGTCTTAGTCATTGG - Intronic
1023559615 7:41460047-41460069 GTGAGCCTGCTCTTCGGCATGGG + Intergenic
1028116474 7:87003098-87003120 CTTAGCAAGCCCTTCTTTATGGG + Intronic
1032683448 7:134208866-134208888 CTGAGCCAGCTCTTGGTTCTGGG - Intronic
1034972355 7:155427238-155427260 CTGAGCCCTCTCTTGGTTGTTGG - Intergenic
1048565043 8:135587208-135587230 CTGAGCCAACTGTTCTTCATCGG + Intronic
1051477318 9:17522340-17522362 CTGAGCCTCCTTTTCCTTATAGG - Intergenic
1052536201 9:29750512-29750534 CTAAGACAGCTCCTTGTTATTGG - Intergenic
1052611063 9:30774198-30774220 CTGAGCCAGCTCTTCGTTATTGG - Intergenic
1203372382 Un_KI270442v1:320600-320622 CTAAGCCATGTCTTCTTTATGGG - Intergenic
1185472180 X:390610-390632 CTGACCCAGCTCTTTGTTCCTGG - Intergenic
1189047571 X:37609923-37609945 CTGAGTCAGCTTTCCATTATTGG + Intronic
1192189254 X:68980812-68980834 CTGACCCAGCTCATGGCTATTGG - Intergenic
1192282863 X:69703016-69703038 CTGAGCCTACCCTCCGTTATGGG - Intronic
1195760165 X:108237099-108237121 CTGAGCTAGGTTTTGGTTATTGG - Intronic
1197617921 X:128715259-128715281 CTGAGCCAGCTTGTCGTATTGGG - Intergenic