ID: 1052611063

View in Genome Browser
Species Human (GRCh38)
Location 9:30774198-30774220
Sequence CTGAGCCAGCTCTTCGTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 77}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052611063_1052611067 23 Left 1052611063 9:30774198-30774220 CCAATAACGAAGAGCTGGCTCAG 0: 1
1: 0
2: 2
3: 6
4: 77
Right 1052611067 9:30774244-30774266 GTACTGGTCTCAGCAGATTGAGG No data
1052611063_1052611064 -10 Left 1052611063 9:30774198-30774220 CCAATAACGAAGAGCTGGCTCAG 0: 1
1: 0
2: 2
3: 6
4: 77
Right 1052611064 9:30774211-30774233 GCTGGCTCAGAAGAACCGAGAGG No data
1052611063_1052611066 7 Left 1052611063 9:30774198-30774220 CCAATAACGAAGAGCTGGCTCAG 0: 1
1: 0
2: 2
3: 6
4: 77
Right 1052611066 9:30774228-30774250 GAGAGGATCTAGAAAAGTACTGG 0: 1
1: 0
2: 5
3: 40
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052611063 Original CRISPR CTGAGCCAGCTCTTCGTTAT TGG (reversed) Intergenic