ID: 1052613206

View in Genome Browser
Species Human (GRCh38)
Location 9:30802418-30802440
Sequence ACTTCAGAAGGTTTTGTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052613206_1052613208 15 Left 1052613206 9:30802418-30802440 CCTCAAACAAAACCTTCTGAAGT No data
Right 1052613208 9:30802456-30802478 TACTCTTATCACAGTATTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052613206 Original CRISPR ACTTCAGAAGGTTTTGTTTG AGG (reversed) Intergenic