ID: 1052614644

View in Genome Browser
Species Human (GRCh38)
Location 9:30822016-30822038
Sequence CTGTGGAAGTAATTGAATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052614638_1052614644 8 Left 1052614638 9:30821985-30822007 CCTTAAATTCCAATGTGTTGTGT No data
Right 1052614644 9:30822016-30822038 CTGTGGAAGTAATTGAATCTTGG No data
1052614640_1052614644 -1 Left 1052614640 9:30821994-30822016 CCAATGTGTTGTGTGAAGGACCC No data
Right 1052614644 9:30822016-30822038 CTGTGGAAGTAATTGAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052614644 Original CRISPR CTGTGGAAGTAATTGAATCT TGG Intergenic
No off target data available for this crispr