ID: 1052616647

View in Genome Browser
Species Human (GRCh38)
Location 9:30851139-30851161
Sequence TCTGGGGACCCTCTCCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052616647_1052616657 19 Left 1052616647 9:30851139-30851161 CCAGGTGGGAGAGGGTCCCCAGA No data
Right 1052616657 9:30851181-30851203 ACACTGGGAGGAATGTGAACTGG No data
1052616647_1052616654 7 Left 1052616647 9:30851139-30851161 CCAGGTGGGAGAGGGTCCCCAGA No data
Right 1052616654 9:30851169-30851191 CAACCAGCCTGCACACTGGGAGG 0: 9
1: 11
2: 46
3: 75
4: 280
1052616647_1052616651 3 Left 1052616647 9:30851139-30851161 CCAGGTGGGAGAGGGTCCCCAGA No data
Right 1052616651 9:30851165-30851187 ACTCCAACCAGCCTGCACACTGG 0: 10
1: 34
2: 61
3: 89
4: 283
1052616647_1052616660 24 Left 1052616647 9:30851139-30851161 CCAGGTGGGAGAGGGTCCCCAGA No data
Right 1052616660 9:30851186-30851208 GGGAGGAATGTGAACTGGGGTGG No data
1052616647_1052616652 4 Left 1052616647 9:30851139-30851161 CCAGGTGGGAGAGGGTCCCCAGA No data
Right 1052616652 9:30851166-30851188 CTCCAACCAGCCTGCACACTGGG 0: 11
1: 39
2: 80
3: 130
4: 295
1052616647_1052616659 21 Left 1052616647 9:30851139-30851161 CCAGGTGGGAGAGGGTCCCCAGA No data
Right 1052616659 9:30851183-30851205 ACTGGGAGGAATGTGAACTGGGG No data
1052616647_1052616658 20 Left 1052616647 9:30851139-30851161 CCAGGTGGGAGAGGGTCCCCAGA No data
Right 1052616658 9:30851182-30851204 CACTGGGAGGAATGTGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052616647 Original CRISPR TCTGGGGACCCTCTCCCACC TGG (reversed) Intergenic
No off target data available for this crispr