ID: 1052618782

View in Genome Browser
Species Human (GRCh38)
Location 9:30878104-30878126
Sequence TGTCCTTTGCAGAACATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052618782_1052618784 -2 Left 1052618782 9:30878104-30878126 CCATCCATGTTCTGCAAAGGACA No data
Right 1052618784 9:30878125-30878147 CATGATCTCATTCTTTTTTATGG 0: 897
1: 4626
2: 12822
3: 22337
4: 12272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052618782 Original CRISPR TGTCCTTTGCAGAACATGGA TGG (reversed) Intergenic
No off target data available for this crispr