ID: 1052619251

View in Genome Browser
Species Human (GRCh38)
Location 9:30884014-30884036
Sequence CAGTGTCTGGTGATGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052619251_1052619256 26 Left 1052619251 9:30884014-30884036 CCATGCTCCATCACCAGACACTG No data
Right 1052619256 9:30884063-30884085 TTAGATGTTCATTTGTTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052619251 Original CRISPR CAGTGTCTGGTGATGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr