ID: 1052629980

View in Genome Browser
Species Human (GRCh38)
Location 9:31025349-31025371
Sequence TTGAAGAAGAATGAGGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052629975_1052629980 2 Left 1052629975 9:31025324-31025346 CCATGAAGAAAGAGAAAGTAGAG No data
Right 1052629980 9:31025349-31025371 TTGAAGAAGAATGAGGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052629980 Original CRISPR TTGAAGAAGAATGAGGTTGA GGG Intergenic
No off target data available for this crispr