ID: 1052635430

View in Genome Browser
Species Human (GRCh38)
Location 9:31097742-31097764
Sequence CCAAATGCTGACAATGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052635427_1052635430 13 Left 1052635427 9:31097706-31097728 CCTACCAAAATGGCTAAAATTTA No data
Right 1052635430 9:31097742-31097764 CCAAATGCTGACAATGATATAGG No data
1052635426_1052635430 20 Left 1052635426 9:31097699-31097721 CCTCACACCTACCAAAATGGCTA No data
Right 1052635430 9:31097742-31097764 CCAAATGCTGACAATGATATAGG No data
1052635428_1052635430 9 Left 1052635428 9:31097710-31097732 CCAAAATGGCTAAAATTTAAATA No data
Right 1052635430 9:31097742-31097764 CCAAATGCTGACAATGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052635430 Original CRISPR CCAAATGCTGACAATGATAT AGG Intergenic
No off target data available for this crispr