ID: 1052636517

View in Genome Browser
Species Human (GRCh38)
Location 9:31113153-31113175
Sequence CTGCTTGCACAGATTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052636517_1052636519 17 Left 1052636517 9:31113153-31113175 CCAGCAGCAATCTGTGCAAGCAG No data
Right 1052636519 9:31113193-31113215 ACCCTCATTTTCAGGCTCCATGG No data
1052636517_1052636518 9 Left 1052636517 9:31113153-31113175 CCAGCAGCAATCTGTGCAAGCAG No data
Right 1052636518 9:31113185-31113207 GAATACTCACCCTCATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052636517 Original CRISPR CTGCTTGCACAGATTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr