ID: 1052641228

View in Genome Browser
Species Human (GRCh38)
Location 9:31167628-31167650
Sequence CCTGCTCTGCAGAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052641228_1052641232 -8 Left 1052641228 9:31167628-31167650 CCTGCTTCCCTCTGCAGAGCAGG No data
Right 1052641232 9:31167643-31167665 AGAGCAGGTTCACTGTGCATTGG No data
1052641228_1052641234 20 Left 1052641228 9:31167628-31167650 CCTGCTTCCCTCTGCAGAGCAGG No data
Right 1052641234 9:31167671-31167693 ATTTCAGCCCACTCCATCTTGGG No data
1052641228_1052641233 19 Left 1052641228 9:31167628-31167650 CCTGCTTCCCTCTGCAGAGCAGG No data
Right 1052641233 9:31167670-31167692 TATTTCAGCCCACTCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052641228 Original CRISPR CCTGCTCTGCAGAGGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr