ID: 1052642909

View in Genome Browser
Species Human (GRCh38)
Location 9:31192409-31192431
Sequence GATCTCACCCTAATGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052642909_1052642913 -8 Left 1052642909 9:31192409-31192431 CCTGCTCCCATTAGGGTGAGATC No data
Right 1052642913 9:31192424-31192446 GTGAGATCAAGGAAAAGTGCAGG No data
1052642909_1052642915 1 Left 1052642909 9:31192409-31192431 CCTGCTCCCATTAGGGTGAGATC No data
Right 1052642915 9:31192433-31192455 AGGAAAAGTGCAGGTATTATGGG No data
1052642909_1052642916 11 Left 1052642909 9:31192409-31192431 CCTGCTCCCATTAGGGTGAGATC No data
Right 1052642916 9:31192443-31192465 CAGGTATTATGGGAATTAAAAGG No data
1052642909_1052642914 0 Left 1052642909 9:31192409-31192431 CCTGCTCCCATTAGGGTGAGATC No data
Right 1052642914 9:31192432-31192454 AAGGAAAAGTGCAGGTATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052642909 Original CRISPR GATCTCACCCTAATGGGAGC AGG (reversed) Intergenic
No off target data available for this crispr