ID: 1052660564

View in Genome Browser
Species Human (GRCh38)
Location 9:31423880-31423902
Sequence CCGACTAAGTAGAAGTAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052660562_1052660564 -8 Left 1052660562 9:31423865-31423887 CCAAAATTTCTGTTTCCGACTAA No data
Right 1052660564 9:31423880-31423902 CCGACTAAGTAGAAGTAGAATGG No data
1052660561_1052660564 0 Left 1052660561 9:31423857-31423879 CCATAAATCCAAAATTTCTGTTT No data
Right 1052660564 9:31423880-31423902 CCGACTAAGTAGAAGTAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052660564 Original CRISPR CCGACTAAGTAGAAGTAGAA TGG Intergenic
No off target data available for this crispr