ID: 1052661340

View in Genome Browser
Species Human (GRCh38)
Location 9:31436181-31436203
Sequence CCTGCTTAGAAGATATTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052661340_1052661342 0 Left 1052661340 9:31436181-31436203 CCAGAAAATATCTTCTAAGCAGG No data
Right 1052661342 9:31436204-31436226 AAAAGAGCAAATGATTGTCAAGG No data
1052661340_1052661343 1 Left 1052661340 9:31436181-31436203 CCAGAAAATATCTTCTAAGCAGG No data
Right 1052661343 9:31436205-31436227 AAAGAGCAAATGATTGTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052661340 Original CRISPR CCTGCTTAGAAGATATTTTC TGG (reversed) Intergenic
No off target data available for this crispr