ID: 1052682598

View in Genome Browser
Species Human (GRCh38)
Location 9:31713309-31713331
Sequence AAATTCCAAAAAATGTATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052682598_1052682602 25 Left 1052682598 9:31713309-31713331 CCCCAATACATTTTTTGGAATTT No data
Right 1052682602 9:31713357-31713379 TTTTGGACACTATAAACAACAGG No data
1052682598_1052682601 8 Left 1052682598 9:31713309-31713331 CCCCAATACATTTTTTGGAATTT No data
Right 1052682601 9:31713340-31713362 ACACGTTTTCTTCATTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052682598 Original CRISPR AAATTCCAAAAAATGTATTG GGG (reversed) Intergenic
No off target data available for this crispr