ID: 1052684236

View in Genome Browser
Species Human (GRCh38)
Location 9:31733936-31733958
Sequence CTGAGAGTTCAGAACTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052684230_1052684236 -2 Left 1052684230 9:31733915-31733937 CCCCACAAAAGACCACTTTGCCT No data
Right 1052684236 9:31733936-31733958 CTGAGAGTTCAGAACTAGGAAGG No data
1052684232_1052684236 -4 Left 1052684232 9:31733917-31733939 CCACAAAAGACCACTTTGCCTGA No data
Right 1052684236 9:31733936-31733958 CTGAGAGTTCAGAACTAGGAAGG No data
1052684228_1052684236 9 Left 1052684228 9:31733904-31733926 CCACTTTTCACCCCCACAAAAGA No data
Right 1052684236 9:31733936-31733958 CTGAGAGTTCAGAACTAGGAAGG No data
1052684229_1052684236 -1 Left 1052684229 9:31733914-31733936 CCCCCACAAAAGACCACTTTGCC No data
Right 1052684236 9:31733936-31733958 CTGAGAGTTCAGAACTAGGAAGG No data
1052684231_1052684236 -3 Left 1052684231 9:31733916-31733938 CCCACAAAAGACCACTTTGCCTG No data
Right 1052684236 9:31733936-31733958 CTGAGAGTTCAGAACTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052684236 Original CRISPR CTGAGAGTTCAGAACTAGGA AGG Intergenic
No off target data available for this crispr