ID: 1052695168

View in Genome Browser
Species Human (GRCh38)
Location 9:31869063-31869085
Sequence CTGTACCAGTAGCAGCAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052695162_1052695168 12 Left 1052695162 9:31869028-31869050 CCAGGCTCACGGGTGGCCCATGT No data
Right 1052695168 9:31869063-31869085 CTGTACCAGTAGCAGCAGATTGG No data
1052695158_1052695168 19 Left 1052695158 9:31869021-31869043 CCAGTCCCCAGGCTCACGGGTGG No data
Right 1052695168 9:31869063-31869085 CTGTACCAGTAGCAGCAGATTGG No data
1052695160_1052695168 14 Left 1052695160 9:31869026-31869048 CCCCAGGCTCACGGGTGGCCCAT No data
Right 1052695168 9:31869063-31869085 CTGTACCAGTAGCAGCAGATTGG No data
1052695167_1052695168 -5 Left 1052695167 9:31869045-31869067 CCATGTGGGTGGTATCAGCTGTA No data
Right 1052695168 9:31869063-31869085 CTGTACCAGTAGCAGCAGATTGG No data
1052695161_1052695168 13 Left 1052695161 9:31869027-31869049 CCCAGGCTCACGGGTGGCCCATG No data
Right 1052695168 9:31869063-31869085 CTGTACCAGTAGCAGCAGATTGG No data
1052695166_1052695168 -4 Left 1052695166 9:31869044-31869066 CCCATGTGGGTGGTATCAGCTGT No data
Right 1052695168 9:31869063-31869085 CTGTACCAGTAGCAGCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052695168 Original CRISPR CTGTACCAGTAGCAGCAGAT TGG Intergenic
No off target data available for this crispr