ID: 1052695503

View in Genome Browser
Species Human (GRCh38)
Location 9:31872176-31872198
Sequence CTGACATTATTACAGGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052695498_1052695503 8 Left 1052695498 9:31872145-31872167 CCCTGCTAATAAAGCAAGAGATG No data
Right 1052695503 9:31872176-31872198 CTGACATTATTACAGGGTTCTGG No data
1052695497_1052695503 18 Left 1052695497 9:31872135-31872157 CCAAATCAAGCCCTGCTAATAAA No data
Right 1052695503 9:31872176-31872198 CTGACATTATTACAGGGTTCTGG No data
1052695499_1052695503 7 Left 1052695499 9:31872146-31872168 CCTGCTAATAAAGCAAGAGATGA No data
Right 1052695503 9:31872176-31872198 CTGACATTATTACAGGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052695503 Original CRISPR CTGACATTATTACAGGGTTC TGG Intergenic
No off target data available for this crispr