ID: 1052697119

View in Genome Browser
Species Human (GRCh38)
Location 9:31891920-31891942
Sequence CTGCATCCAAAAATGAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052697117_1052697119 5 Left 1052697117 9:31891892-31891914 CCTACCTTGTTCTTTTAAAGCAA No data
Right 1052697119 9:31891920-31891942 CTGCATCCAAAAATGAAGCATGG No data
1052697115_1052697119 15 Left 1052697115 9:31891882-31891904 CCATGCCTGGCCTACCTTGTTCT No data
Right 1052697119 9:31891920-31891942 CTGCATCCAAAAATGAAGCATGG No data
1052697114_1052697119 18 Left 1052697114 9:31891879-31891901 CCACCATGCCTGGCCTACCTTGT No data
Right 1052697119 9:31891920-31891942 CTGCATCCAAAAATGAAGCATGG No data
1052697118_1052697119 1 Left 1052697118 9:31891896-31891918 CCTTGTTCTTTTAAAGCAATGAC No data
Right 1052697119 9:31891920-31891942 CTGCATCCAAAAATGAAGCATGG No data
1052697116_1052697119 10 Left 1052697116 9:31891887-31891909 CCTGGCCTACCTTGTTCTTTTAA No data
Right 1052697119 9:31891920-31891942 CTGCATCCAAAAATGAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052697119 Original CRISPR CTGCATCCAAAAATGAAGCA TGG Intergenic
No off target data available for this crispr